
Primers available for Premium Service
Primer Name |
Primer Express Tm @ 50nM, 50mM NaCl |
Primer Sequence 5'-3' |
size (nt) |
Primer Dimer? (by Primer Express) |
BGH_Reverse_Long |
64.1 ºC |
ACTAGAAGGCACAGTCGAGGCTGATC |
26 |
Possible |
BGH_Reverse_Core |
61.2 ºC |
TAGAAGGCACAGTCGAGGCTGAT |
23 |
Not likely |
BGH_Reverse_Invitrogen |
50.6 ºC |
TAGAAGGCACAGTCGAGG |
18 |
Not likely |
|
|
|
|
|
M13/pUC_Forward |
53.7 ºC |
TGTAAAACGACGGCCAGT |
18 |
Yes |
M13/pUC_Forward_23 |
69.8 ºC |
CGCCAGGGTTTTCCCAGTCACGA |
23 |
Not likely |
|
|
|
|
|
M13/pUC_Reverse |
54.1 ºC |
TCACACAGGAAACAGCTATGAC |
22 |
Not likely |
M13/pUC_Reverse_GC+ |
54.3 ºC |
GCTATGACCATGATTACGCC |
20 |
Not likely |
|
|
|
|
|
SP6_Promega |
35.5 ºC |
TATTTAGGTGACACTATAG |
19 |
Not likely |
SP6_NEB_24 |
47.0 ºC |
CATACGATTTAGGTGACACTATAG |
24 |
Not likely |
SP6_Core |
43.5 ºC |
ATTTAGGTGACACTATAGAATAC |
23 |
Not likely |
|
|
|
|
|
T7 Promoter (Promega) |
43.4 ºC |
TAATACGACTCACTATAGGG |
20 |
Possible |
T7 Promoter Neo (Core) |
38.4 ºC |
TAATACGACTCACTATAGG |
19 |
Not likely |
|
|
|
|
|
T7_Promoter_EEV_Promega |
|
AAGGCTAGAGTACTTAATACGA |
22 |
|
|
|
|
|
|
T7_Terminator |
52.6 ºC |
GCTAGTTATTGCTCAGCGG |
19 |
Possible |
|
|
|
|
|
T3_Promega |
49.4 ºC |
ATTAACCCTCACTAAAGGGA |
20 |
Not likely |
Primer Comments
- BGH primers anneal to pKPPURO, pNKTV1907, pcDNA3, pcDNA3.1, pcDNA3.1/Neo, pCR3.1, pIRE51hyg, pIRE51 neo
- M13R/pUC Reverse (=M13R) primer does have some homology with common vectors at the 3' end and can produce some background.
- M13/pUC_Reverse_GC+ (M13R GC+) primer was designed to avoid this problem and works with most pUC-, pGEM-, and pBluescript-derived plasmids. However, there are some vectors on which it will not work due to different sequence at 3’ and / or 5’ ends
- M13 R primer anneals to some plasmids at the primers 3’ end 16 bp or greater, but not the full length.
- SP6 primer does not match with sequence at the 3’ end of the SP6 genome perfectly. Therefore, the different SP6 primers do not match all vectors with "SP6" primer sites as the sequences differ slightly.
- T7 promoter Promega primer does not match 8 out of many other plasmids at the 3’ end.
- T7 promoter Neo (core) primer can be used to sequence both the vectors with normal T7 promoter sequence and pCIneo-derived vectors with the shorter T7 sequence which have two Gs at 3' end; whereas T7 primers has three Gs.
- T7 promoter EEV Promega is utilized by Promega to sequence pCIneo derived vectors and the inserts they carry.
Vector Comments
- Invitrogen pCRII vector (had SP6 and T7 primer sites). Due to a Promega patent on the SP6 sequence, Invitrogen had to remove the SP6 site to make the pCR2.1 vector, which does not have an SP6 site.
Before specifying a particular primer for DNA sequencing, verify the primer site sequence is present in your vector.
©1995-2012 University of Colorado Anschutz Medical Campus DNA Sequencing & Analysis Core